* Develop our own server for working with DNA sequences
* Develop our own server for working with DNA sequences
...
@@ -27,19 +27,19 @@
...
@@ -27,19 +27,19 @@
## Introduction
## Introduction
The goal of this practice is to develop our own **Seq** server for working with **DNA sequences**. We have been working with DNA sequences for many sessions, but always in our local computer. Now we will make these calculations available to other applications on Internet
The goal of this new assignment is to develop our own **Seq** server to work with **DNA sequences**. We have been working with DNA sequences for many sessions, but always in our local computer. Now we will make these calculations available to other applications on Internet
The first step is to **define** the set of **rules** and **commands** that the **clients** need to follow in order to access the **services** given by our **server**: we should define the **protocol**
The first step is to **define** the set of **rules** and **commands** that the **clients** need to follow in order to access the **services** given by our **server**: we should define the **protocol**
| Service name | Request message | Argument | Response message | Description |
| Service name | Request message | Argument | Response message | Description |
| **PING** | "PING" | none | "OK" | Ping service for testing if the server is alive of not |
| **PING** | "PING" | none | "OK" | Ping service for testing whether the server is alive of not |
| **GET** | "GET n" | n: 0-4 | A sequence | Get the sequence n. It could be any valid sequence of any length. There are only 5 sequences, numbered from 0 to 4 |
| **GET** | "GET n" | n: 0-4 | A sequence | Gets sequence n. It could be any valid sequence of any length. There are only 5 sequences, numbered from 0 to 4 |
| **INFO** | "INFO seq" | seq: A sequence | See format below | Get information about the given sequence: total length, number of bases and their percentages |
| **INFO** | "INFO seq" | seq: A sequence | See format below | Gets information about a specific sequence: total length, number of bases, and their percentages |
| **COMP** | "COMP seq" | seq: A sequene | The complement sequence | Calculate the complement of the given sequence |
| **COMP** | "COMP seq" | seq: A sequene | The complement sequence | Calculates the complement of a specific sequence |
| **REV** | "REV seq" | seq: A sequence | The reverse sequence | Calculate the reverse of the given sequence |
| **REV** | "REV seq" | seq: A sequence | The reverse sequence | Calculatea the reverse of a specific sequence |
| **GENE** | "GENE name" | Gene name. See format below | The sequence of the gene | Get the complete sequence of the given GENE |
| **GENE** | "GENE name" | Gene name. See format below | The sequence of the gene | Gets the complete sequence of a specific GENE |
The response message returned by the **INFO** service should be like this example:
The response message returned by the **INFO** service should be like in the following example:
```
```
Sequence: ATAGACCAAACATGAGAGGCT
Sequence: ATAGACCAAACATGAGAGGCT
...
@@ -50,155 +50,153 @@ G: 5 (23.8%)
...
@@ -50,155 +50,153 @@ G: 5 (23.8%)
T: 3 (14.3%)
T: 3 (14.3%)
```
```
The names of the genes that are **valid**when calling the **GENE service** are: **U5**, **ADA**, **FRAT1**, **FXN**, **RNU6_269P**
The names of the **valid**genes to call the **GENE service** are: **U5**, **ADA**, **FRAT1**, **FXN**, and **RNU6_269P**
The server will be programmed **step by step**, following the guides given in the **exercises**
The server will be programmed **step by step**, following the guidelines given in the **exercises**.
## Localhost IP address
## Localhost IP address
There is a special **IP** address: **127.0.0.1**, which is used to identify **your local machines**. When programming a server, instead of having to used the real IP, it is\*\* easier to use this IP. Doing so, you do not have to change the code when running the server in a different computer
There is a special **IP** address: **127.0.0.1**, which is used to identify **your local machines**. When programming a server, instead of having to used the real IP, it is much easier to use this IP. By doing so, you do not have to change the code when running the server in a different computer.
**We will always use the 127.0.0.1 address** in our servers
**We will always use the 127.0.0.1 address** in our local servers.
## Exercises
## Exercises
We will implement the **Seq Server** and develop some example clients for testing it. While developing the server, we will use the **printf** and **nc** linux commands for **sending messages** to the **server**. But you can also do it from your own client, if you like
We will implement the **Seq Server**, and develop some clients to test it. While developing the server, we will use the **echo** and **nc** linux commands for **sending messages** to the **server**. But you can also do it from your own client if you like.
The server will be stored in the **Seq-Server.py file** inside **folder P3**
The server will be stored in a file called **Seq-Server.py** within a folder with name **P03**. You will need to use the **Seq1 module** developed in **P01**, and extend it.
you should use the **Seq1 module** developed in **practice 1**
### Exercise 1: PING
### Exercise 1: PING
***Filename:** P3/Seq-Server.py
***Filename:** P03/Seq-server.py
Let's start by programming a server that implements the **PING command**. The client will send a message with the word **PING**. Then, the server should **parse** the request message. If the PING command is **detected**, it should generate the response message **"OK!\\n"**. Also, it should**print on the console** the message "PING command!" in GREEN, and then the response message in white
Let's start programming a server that implements the **PING command**. The client will send a message with the word **PING**; then, the server **parses** the request message so if the PING command is **detected**, it generates the response message **"OK!\\n"**. Also, it needs to**print on the console** the message "PING command!" in green, and then the response message in white.
For **testing the server** we use this command, executed from the **command line**:
For **testing the server** we can use the following command:
```
```
printf "PING" | nc 127.0.0.1 8080
echo "PING" | nc 127.0.0.1 8080
```
```
This is what we will see on the **linux console**:
This is what we will see on the **linux console**:
Modify the Seqserver for implementing the **GET command**. The client sends a message with the word **GET** followed by a **number** between **0** and **4**. The server will return a **response message** with a **sequence** associated to that number. These sequences are for testing purposes, therefore you can use whatever sequences you want. They should be stored into a **list**. The server uses the number received in the GET command for accessing this list and **returning the sequence**
Modify the Seq-server to implement the **GET command**. The client sends a message with the word **GET** followed by a **number** between **0** and **4**. The server will return a **response message** with a **sequence** associated to that number. These sequences are for testing purposes, so you can use whatever sequences you want; stored them into a **list** that the server uses to index with the received parameter.
For **testing the server** we use this command, executed from the **command line**:
Use the following command to test the server:
```
```
printf "GET 2" | nc 127.0.0.1 8080
echo "GET 2" | nc 127.0.0.1 8080
```
```
In this example the client is asking for the sequence number 2
In this example the client is asking for the sequence number 2.
Modify the Seq server for implementing the **INFO command**. The client sends a message with the word **INFO** followed by a sequence. The server will return a **response message** with information about that sequence. This information should be obtained using the **Seq Class**
Modify the Seq server for implementing the **INFO command**. The client sends a message with the word **INFO** followed by a sequence. The server will return a **response message** with information about that sequence. This information should be obtained using the **Seq Class**.
For **testing the server** we use commands like this, executed from the **Linux's command line**:
For **testing the server** we can use use the following command:
Modify the Seq server for implementing the **COMP command**. The client sends a message with the word **COMP** followed by a sequence. The server will return a **response message** with the complement of that sequence. It should be obtained using the **Seq Class**
Upgrade the Seq server to respond to the **COMP command**. The client sends a message with the word **COMP** followed by a sequence. The server will return a **response message** with the complement of that sequence. It must be obtained using the **Seq Class**.
For **testing the server** we use commands like this, executed from the **Linux's command line**:
Modify the Seq server for implementing the **REV command**. The client sends a message with the word **REV** followed by a sequence. The server will return a **response message** with the reverse of the given sequence. It should be obtained using the **Seq Class**
Modify the Seq server and implement the **REV command**. The client sends a message with the word **REV** followed by a sequence. The server will return a **response message** with the reverse of the sequence. It must be obtained using the **Seq Class**.
For **testing the server** we use commands like this, executed from the **Linux's command line**:
Modify the Seq server for implementing the **GENE command**. The client sends a message with the word **REV** followed by a **gene name**: U5, ADA, FRAT1, FXN or RNU6_269P. The server will return a **response message** with the complete sequence of that gene. It should be obtained using the **Seq Class** (and reading the gene from the corresponding file)
Work on the Seq server and implementing the **GENE command**. The client sends a message with the word **GENE** followed by a **gene name**: U5, ADA, FRAT1, FXN, or RNU6_269P. The server will return a **response message** with the whole sequence corresponding to that gene. It must be obtained using the **Seq Class** (and reading the gene from the corresponding file).
For **testing the server** we use commands like this, executed from the **Linux's command line**: